Adenovirus expressing human pri-miR hsa-mir-483
Cat. No: ADV-MI0002467
Availability:
3-5 weeks
Name:
Ad-EF1a-hsa-mir-483-eGFP
This is an Adenovirus expressing Human pre-miRNA hsa-mir-483 under an EF1a promoter. This virus also has an eGFP as reporter.
We can also make this miRNA Adenovirus with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
We can also make this miRNA Adenovirus with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
Request a Quote
Please enter your email address and we'll be in touch with more information:
Viral Details
- Viral Backbone
- Human Adenovirus Type5 (dE1/E3)
- Promoter
- EF1a
- Reporter
- eGFP
- Storage Buffer
- DMEM, 2% BSA, 2.5% Glycerol
- Volume
- 200ul
Gene Details
- Species
- Human
- RefSeq#
- MI0002467
- pre-miRNA Name
- hsa-mir-483
- pre-miRNA Accession#
- MI0002467
- pre-miRNA Sequence
- GAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUUCCAUCACGCCUCCUCACUCCUCUCCUCCCGUCUUCUCCUCUC
- Mature miRNA 1 Name
- hsa-miR-483-5p
- Mature miRNA 1 Accession#
- MIMAT0004761
- Mature 1 Sequence
- AAGACGGGAGGAAAGAAGGGAG
- Mature miRNA 2 Name
- hsa-miR-483-3p
- Mature miRNA 2 Accession#
- MIMAT0002173
- Mature 2 Sequence
- UCACUCCUCUCCUCCCGUCUU
Control Products
Product | Cat No. |
---|---|
Ad-EF1a-Ctrl-miR-GFP | 1914 |
Vector Biolabs
293 Great Valley Parkway
Malvern, PA 19355
Email: info@vectorbiolabs.com
Phone: +1 484-325-5100
Toll-free (US Only): 877-BIO-LABS
Fax: +1 215-525-1112
Privacy Policy