AAV expressing rat pri-miR rno-mir-214
Cat. No: AAV-MI0000954
Availability:
3-4 weeks
Name:
AAV-EF1a-rno-mir-214-eGFP
This is an AAV expressing Rat pre-miRNA rno-mir-214 under an EF1a promoter. This virus also has an eGFP as reporter.
We can also make this miRNA AAV with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
We can also make this miRNA AAV with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
Request a Quote
Please enter your email address and we'll be in touch with more information:
Viral Details
- Viral Backbone
- Recombinant AAV
- AAV-ITR
- AAV2
- AAV Serotype
- Choose from AAV 1, AAV2, AAV3, AAV5, AAV6, AAV8, AAV9, AAV-DJ, DJ8, DJ9 and other wildtype/synthetic AAV capsids
- Promoter
- EF1a
- Reporter
- eGFP
- Storage Buffer
- PBS/5% Glycerol
- Volume
- 200ul
Gene Details
- Species
- Rat
- RefSeq#
- MI0000954
- pre-miRNA Name
- rno-mir-214
- pre-miRNA Accession#
- MI0000954
- pre-miRNA Sequence
- GUCCUGGAUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU
- Mature miRNA 1 Name
- rno-miR-214*
- Mature miRNA 1 Accession#
- MIMAT0017159
- Mature 1 Sequence
- AGAGUUGUCAUGUGUCU
- Mature miRNA 2 Name
- rno-miR-214
- Mature miRNA 2 Accession#
- MIMAT0000885
- Mature 2 Sequence
- ACAGCAGGCACAGACAGGCAG
Control Products
Product | Cat No. |
---|---|
scAAV-EF1a-ctrl-miR-eGFP | 7133 |
Vector Biolabs
293 Great Valley Parkway
Malvern, PA 19355
Email: info@vectorbiolabs.com
Phone: +1 484-325-5100
Toll-free (US Only): 877-BIO-LABS
Fax: +1 215-525-1112
Privacy Policy