AAV expressing mouse pri-miR mmu-mir-34a
This is an AAV expressing Mouse pre-miRNA mmu-mir-34a under an EF1a promoter. This virus also has an eGFP as reporter.
We can also make this miRNA AAV with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
AAV-MI0000584
AAV-EF1a-mmu-mir-34a-eGFP
Ready-to-use AAV expressing Mouse pre-miRNA mmu-mir-34a under EF1a promoter with eGFP reporter. Available in AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, AAV-DJ and other serotypes.
miRNA Reference Data
Label (English)
mmu-mir-34a
Mature miRNA 1 Accession
MIMAT0000542
Mature miRNA 1 ID
mmu-miR-34a-5p
Mature miRNA 1 Sequence
UGGCAGUGUCUUAGCUGGUUGU
Mature miRNA 2 Accession
MIMAT0017022
Mature miRNA 2 ID
mmu-miR-34a-3p
Mature miRNA 2 Sequence
AAUCAGCAAGUAUACUGCCCU
Pre-miRNA Accession
MI0000584
Pre-miRNA ID
mmu-mir-34a
Pre-miRNA Sequence
CCAGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGU
Reference Entity Identifier
mirna
RefSeq ID
MI0000584
Recently Viewed Products
Ad-CMV-iCre
Cat No: 1045
Ad-CMV-Caspase 9 (DN)
Cat No: 1044
Ad-CMV-Rb
Cat No: 1043
Ad-CMV-p27
Cat No: 1042
About Storage Conditions
All our viral products should be kept at -80°C. At this temperature, the virus will remain stable for 6-12 months (and in some cases, up to 2 years). Once thawed, the product can be stored at 4°C for 2-3 weeks without significant loss of biological activity.
We recommend aliquoting your vectors into low protein binding tubes upon receipt. This helps avoid repeated freeze-thaw cycles, as well as prevent loss of virus. To maintain accurate titer, aliquot in at least 20ul per tube.
