Adenovirus expressing mouse pri-miR mmu-mir-206
This is an Adenovirus expressing Mouse pre-miRNA mmu-mir-206 under an EF1a promoter. This virus also has an eGFP as reporter.
We can also make this miRNA Adenovirus with a different promoter (ubiquitous or cell-specific) or a fluorescence reporter other than eGFP. To learn more, simply request a quote with the details of your request.
ADV-MI0000249
Ad-EF1a-mmu-mir-206-eGFP
Ready-to-use Adenovirus expressing Mouse pre-miRNA mmu-mir-206 under EF1a promoter with eGFP reporter. Also available with cell-speciifc promoter or different fluorescence reporter.
miRNA Reference Data
Label (English)
mmu-mir-206
Mature miRNA 1 Accession
MIMAT0017004
Mature miRNA 1 ID
mmu-miR-206-5p
Mature miRNA 1 Sequence
ACAUGCUUCUUUAUAUCCUCAUA
Mature miRNA 2 Accession
MIMAT0000239
Mature miRNA 2 ID
mmu-miR-206-3p
Mature miRNA 2 Sequence
UGGAAUGUAAGGAAGUGUGUGG
Pre-miRNA Accession
MI0000249
Pre-miRNA ID
mmu-mir-206
Pre-miRNA Sequence
CCAGGCCACAUGCUUCUUUAUAUCCUCAUAGAUAUCUCAGCACUAUGGAAUGUAAGGAAGUGUGUGGUUUUGG
Reference Entity Identifier
mirna
RefSeq ID
MI0000249
About Storage Conditions
All our viral products should be kept at -80°C. At this temperature, the virus will remain stable for 6-12 months (and in some cases, up to 2 years). Once thawed, the product can be stored at 4°C for 2-3 weeks without significant loss of biological activity.
We recommend aliquoting your vectors into low protein binding tubes upon receipt. This helps avoid repeated freeze-thaw cycles, as well as prevent loss of virus. To maintain accurate titer, aliquot in at least 20ul per tube.
